Burkholderia pseudomallei
I. Organism Information
A. Taxonomy Information
-
Species:
-
Burkholderia pseudomallei
:
-
Ontology: UMLS:C0033819
-
GenBank Taxonomy No.:
28450
-
Description:
Melioidosis is an infectious disease of humans and animals caused by Burkholderia pseudomallei. It was first described under the name Bacillus pseudomallei by Whitmore and Krishnaswami (1912) following its isolation in Rangoon, Myanmar (Burma) more than 90 years ago. Subsequent reports described the causative agent under a variety of names, including Bacillus whitmori, Pfeifferella whitmori, Pfeifferella pseudomallei, Actinobacillus pseudomallei, Loefferella whitmori, Malleomyces pseudomallei and Pseudomonas pseudomallei. Melioidosis has to be considered an emerging disease with high impact on animal and man. In the past century, it has spread from East Asia to many parts of the world previously not affected. Today it can be imported to regions with inappropriate climate if a subclinical carrier capable of contaminating its surroundings survives. Sporadic acute cases may also be seen in animals imported from enzootic areas (Sprague and Neubauer, 2004).
-
Variant(s):
-
Burkholderia pseudomallei (Ara- biotype)
(Sirisinha et al., 1998):
-
Description:
The presence of two distinct biotypes in soil can be reliably distinguished by their ability to assimilate L-arabinose. Whereas some soil isolates could utilize this substrate (Ara+), the remaining soil isolates and all clinical isolates tested so far could not (Ara-) (Sirisinha et al., 1998).
The Ara- biotype is virulent (Sonthayanon et al., 2002).
The Ara- biotype is found in almost all B. pseudomallei clinical isolates (Thepthai et al., 2001).
There was no significant difference between the LD(50)s for clinical and soil Ara- isolates (Smith et al., 1997).
-
Burkholderia pseudomallei (Ara+ biotype)
(Website 2):
-
Burkholderia pseudomallei K96243
(Website 3):
-
GenBank Taxonomy No.:
272560
-
Description:
The classical arabinose-negative B. pseudomallei isolate K96243 (Songsivilai and Dharakul, 2000).
B. pseudomallei strain K96243 was isolated in 1996 from a 34-year-old female diabetic patient in Khon Kaen hospital in Thailand (Holden et al., 2004).
The Burkholderia pseudomallei K96243 genome contains multiple type IV pilin-associated loci, including one encoding a putative pilus structural protein (pilA). A pilA deletion mutant has reduced adherence to human epithelial cells and is less virulent in the nematode model of virulence and the murine model of melioidosis, suggesting a role for type IV pili in B. pseudomallei virulence (Essex-Lopresti et al., 2005).
B. Lifecycle Information
:
-
Burkholderia pseudomallei cells
:
-
Size:
The bacteria are small (0.8 x 1.5 m) (Sprague and Neubauer, 2004).
-
Shape:
Burkholderia pseudomallei, a causative agent of melioidosis, is a facultative intracellular gram-negative bacillus (Kespichayawattana et al., 2004).
-
Picture(s):
-
TEXT (Website 32):
Description:
TEXT (Website 32)
-
Description:
B. pseudomallei occurs as a soil organism in Southeast Asia and northern Australia, and incidents of melioidosis are generally confined to these endemic areas (Woods et al., 1999).
C. Genome Summary:
-
Genome of
Burkholderia pseudomallei
-
Description:
The complete genome of B. pseudomallei strain K96243 consists of two circular replicons (European Molecular Biology Laboratory accession nos. BX571965 [GenBank] and BX571966 [GenBank] ) of 4.07 Mb and 3.17 Mb each that have been designated chromosome 1 and chromosome 2. Genomic comparisons with closely and more distantly related bacteria revealed a greater level of gene order conservation and a greater number of orthologous genes on the large chromosome, suggesting that the two replicons have distinct evolutionary origins (Holden et al., 2004).
-
Burkholderia pseudomallei K96243 chromosome 1:
-
GenBank Accession Number:
NC_006350
-
Size:
4.07 Mb (Holden et al., 2004).
-
Gene Count:
3,460 coding sequences (CDSs) (Holden et al., 2004).
-
Description:
The large chromosome encodes many of the core functions associated with central metabolism and cell growth (Holden et al., 2004).
-
Burkholderia pseudomallei K96243 chromosome 2:
-
GenBank Accession Number:
NC_006351
-
Size:
3.17 Mb (Holden et al., 2004).
-
Gene Count:
2,395 coding sequences (CDSs) (Holden et al., 2004).
-
Description:
The small chromosome carries more accessory functions associated with adaptation and survival in different niches (Holden et al., 2004).
II. Epidemiology Information
A. Outbreak Locations:
-
Melioidosis occurs in tropical areas between latitudes 20N and 20S, predominantly in Southeast Asia and Northern Australia. Cases in animals have also been reported from Australia, Thailand, the Indian subcontinent, Iran, Saudi Arabia, United Arab Emirates, Chad and South Africa, South Africa, Taiwan, Singapore, Brazil and France. B. pseudomallei has been isolated from horses in Spain. In Western Europe, the outbreak of melioidosis at the Paris Zoo in 1975 was doubtless the most unusual spread of B. pseudomallei in a non-endemic region. This outbreak subsequently spread to other zoos in Paris and Mulhouse and equestrian clubs throughout France, and led to the death or slaughter of an unknown number of animals and at least two human fatalities. In 1992, an outbreak of melioidosis in Britain in primates imported from the Philippines and Indonesia. This outbreak was a further reminder of the potential risks posed by the introduction of environmental foci of B. pseudomallei into non-endemic countries (Sprague and Neubauer, 2004).
The highest documented rate being in northeastern Thailand, where melioidosis accounts for 20% of all community-acquired septicaemias (Holden et al., 2004).
In Thailand, the first case report appeared in 1955. At present, 20003000 cases of clinical melioidosis are estimated to occur each year in Thailand with a population of 60000000. The incidence rate in highly endemic areas was calculated to be 3.65.5 cases per 100000 population and is seasonal (Leelarasamee, 2000).
Melioidosis in Vietnam can be traced back to 1937 when a case of cervical melioidosis was reported in a local journal. Then, 30 years later many American soldiers suffered from fatal pneumonitis during the Vietnam war. Vietnam is also claimed to be an original source of B. pseudomallei afflicting travelers or soldiers who developed melioidosis after their visit. At least ten human isolates and five environmental isolates have been recently studied and their cellular lipid and fatty acid composition investigated. Melioidosis is therefore an emerging disease in Vietnam. With a 60000000 population similar to Thailand, we expect to see in the near future many more reported cases with a variety of clinical manifestations similar to what has been found in Malaysia, Singapore and Thailand (Leelarasamee, 2000).
Melioidosis was first described from Australia in an outbreak in sheep in 1949 in Winton, north Queensland. The first human case described was a 32-year-old diabetic from Townsville, north Queensland, who developed fatal septicemic melioidosis. Another case in north Queensland was documented from 1959 and the first reported case in the Northern Territory (NT) was from 1960. Between 1981 and 1983, there were 159 cases of melioidosis in piggeries in the region of the Burnett River. The cases were attributed to a contaminated water supply, possibly associated with preceding heavy rainfall and river flooding and construction of a dam. There have been subsequent sporadic cases of melioidosis of animals in the region up until at least 1996. While this subtropical area is endemic for melioidosis in animals, by far the majority of human cases still occurs above 20S, with disease recognised across northern Australia. The largest numbers of cases are documented at hospital (12S), followed by hospitals in Cairns (17S) and Townsville (19S). Cases are also seen at the smaller hospitals in Mt Isa in western Queensland and Kununurra, Halls Creek, Derby and Broome in the Kimberley region of north Western Australia. The incidence of disease is highest in the north of the NT and possibly also in the small population in the Torres Strait Islands adjacent to Papua New Guinea (PNG) in far north Queensland. It was the situation in the first case diagnosed in Sydney in 1966, recognised at autopsy in a man who had had various septic presentations over a 19-year period. Infection was thought to have possibly been acquired in New Guinea during World War II (Currie et al., 2000 (a)).
In addition to the above case, another case was attributed to World War II service in Papua New Guinea (PNG), making a latent period of 24 years from exposure to fatal melioidosis. This patient was from Brisbane and therefore it is also possible that there had been exposure to introduced infection. However, since 1964 at least six cases of melioidosis (four fatal) have been documented from Port Moresby (Currie et al., 2000 (a)).
Cases of human melioidosis have been reported from several Indian states in recent years, including Maharashtra, Kerala, Orissa, Tripura, Tamil Nadu, West Bengal, Assam, and possibly Pune, although the evidence for the last is questionable. Of villagers in a rice growing area near Vellore 10.7% were found to be sero-positive (Dance, 2000 (b)).
B. pseudomallei, which was previously known to be endemic in Hong Kong, has now repeatedly been isolated from the environment in the island of Hainan and the southern provinces of Guangdong and Guangxi. Furthermore, 16 animal and seven human cases have been reported from these provinces, and a sero-positivity rate of 3.815.2% has been found in the human population. Furthermore, two indigenous cases have recently been reported from Taiwan (Dance, 2000 (b)).
There has been very little recent evidence of melioidosis activity in sub-Saharan Africa. An environmental survey in Kenya yielded no isolates of typical B. pseudomallei from 152 soil and water samples. The only case of melioidosis reported since 1991 occurred in a goat in Transvaal, South Africa, although independent confirmation of the identity of this isolate has not been obtained (Dance, 2000 (b)).
There have been several isolations of B. pseudomallei reported from the Middle East in the last few years, although none of these has been independently confirmed and so doubt as to the accuracy of the identifications must remain. Sources have included humans (Shibl et al., 1996) and animals in Saudi Arabia, a lake in Egypt, milk in Turkey and a camel in the United Arab Emirates (Dance, 2000 (b)).
Three human cases of melioidosis, each confirmed by independent Reference Laboratories, have been reported in the past 4 years. These originated from Martinique, Guadeloupe and Puerto Rico. The Caribbean must thus be regarded as endemic for melioidosis, although further work is needed to determine just how common the disease is there and how widely it is distributed (Dance, 2000 (b)).
All recent isolates from other non-endemic areas appear to have been imported from known endemic areas. There has been no repeat of the outbreak described in France in the mid-1970s and known as Laffaire du Jardin des Plantes. Isolates from this latter outbreak have been examined, however, and appear phenotypically indistinguishable from clinical isolates of B. pseudomallei from elsewhere in the world, although belonging to distinct genotypes (Dance, 2000 (b)).
Imported melioidosis in the UK acts as a mirror on the rest of the world and provides further evidence that melioidosis is widely distributed in the Indian sub-continent. Of 15 human cases diagnosed in the UK between 1988 and 1998, five originated from Bangladesh and one each from India and Pakistan. Interestingly, cases of melioidosis have also been seen in the UK in monkeys and/or humans from both Indonesia and the Philippines, reflecting endemicity in these two countries, in both of which the disease is seldom if ever diagnosed (Dance, 2000 (b)).
B. Transmission Information:
-
From:
Burkholderia pseudomallei Environmental Reservoir To:
Human (Currie, 2003):
Mechanism:
It is now clear that humans and animals are infected by exposure to B. pseudomallei present in soil and surface water in endemic locations (Currie, 2003).
There are several modes of acquisition of melioidosis for which there is strong evidence. These include the inoculation of environmental organisms through penetrating wounds or into existing skin lesions, the aspiration of contaminated water during near-drowning episodes and iatrogenic inoculation (Dance, 2000 (a)).
A comprehensive review of 252 cases of melioidosis were studied prospectively over a 10 year period described the epidemiological features of the disease in Darwin, northern Australia. Patients ranged from 16 months to 91 years old (mean 47 years, median 49 years), although only 4% were children under 15 years of age. Males outnumbered females 3 : 1. A total of 85% of cases presented during the rainy season; 80% had risk factors that may have predisposed them to infection, particularly diabetes mellitus (37%), alcohol abuse (39%), chronic lung disease (27%), chronic renal disease (10%), and consumption of a local root infusion known as kava (8%). Alcohol abuse and chronic lung disease have not emerged as risk factors for melioidosis in Thailand, and this warrants further study. Cystic fibrosis also appears to be a previously unrecognized risk factor for pulmonary melioidosis, and a total of 10 such cases were identified at the recent World Melioidosis Congress in Australia. Patients with diabetes, chronic renal disease or cystic fibrosis who are travelling to endemic areas should probably be warned of the risk of melioidosis, although this risk is impossible to quantify. A recent case of melioidosis acquired in temperate southern Queensland was a reminder that the disease is not confined to the tropics. The precise mode of infection with B. pseudomallei is often unknown, although most cases are assumed to be acquired by inoculation. However, cases can occur in tourists with no obvious soil or water contact (Dance, 2002).
Sporadic cases have resulted from iatrogenic inoculation, laboratory accidents (Dance, 2000 (a)).
Serologic follow-up of 60 laboratory workers over 15 years identified three workers with titers suggestive of subclinical infection, consistent with the background seroprevalence in the local community. These data suggest that infection is not easily acquired from routine, open-bench laboratory work with B. pseudomallei (CDC Report, 2004).
-
From:
Human To:
Human (Dance, 2000 (a)):
Mechanism:
The evidence for other modes of infection, such as person-to-person, animal-to-person, inhalation of environmental organisms, ingestion of environmental organisms, and vector transmission, is relatively weak (Dance, 2000 (a)).
Person-to-person transmission of B. pseudomallei is very unusual (Currie, 2003).
Venereal transmission was the first report of person-to-person spread of B. pseudomallei infection (McCormick et al., 1975).
Two cases of maternal to child transmission of melioidosis are reported from Australia's tropical north. One infant died of overwhelming sepsis. Both lactating mothers had mastitis. In 1 case, Burkholderia pseudomallei isolated from breast milk was identical on pulsed-field gel electrophoresis with that in blood and cerebrospinal fluid isolates from the infant (Ralph et al., 2004).
-
From:
Animals To:
Human (Sprague and Neubauer, 2004):
Mechanism:
Zoonotic transmission to humans is extremely unusual, but there are many similar epidemiological and clinical features of melioidosis in animals and humans (Choy et al., 2000).
Experimental animals have been infected by inhalation and this mode of acquisition was thought to account for the predominance of helicopter crew with pulmonary melioidosis during the Vietnam War (Dance, 2000 (a)).
C. Environmental Reservoir:
-
Burkholderia pseudomallei Environmental Reservoir
:
-
Description:
The environmental reservoirs for B. pseudomallei are surface water and soil (CDC Report, 2004).
Burkholderia pseudomallei is a natural saprophyte that can be isolated from soil and muddy water in endemic areas. It lives in the rhizosphere and is believed to play an important role in denitrification. The agent can be found in soil and clay layers from the surface but more often and regularly in deeper layers from 25 to 120 cm. B. pseudomallei can multiply in soil at a pH from 4 to 8, at a minimal humidity of 10-15% and at temperatures from 4 to 42C but not in estuarine or salt water. It has been noted that the isolation rate was high in places used by animals to rest in the shade. Aerotaxis may account for the bacteria moving actively from deeper layers to the surface soil if it is moistened, e.g. by rain or agricultural practices. The type of soil seems not to be a major factor. The minimum isotherm for a steady establishment in a new geographic area seems to be 11C (Sprague and Neubauer, 2004).
-
Survival Information:
Burkholderia pseudomallei can survive in water at room temperature for up to 8 weeks, in muddy water for up to 7 months and in soil in the laboratory for up to 30 months. The bacterium is not particularly resistant to UV-irradiation or sunlight. Chlorine has only a bacteriostatic effect on the agent as bacteria were recovered from water containing up to 1000 p.p.m. free chlorine. Lower pH additionally reduces the effect of the disinfectant. However, it can effectively reduce the number of viable bacteria (Sprague and Neubauer, 2004).
We still know very little about the climatic, physical, chemical and biological factors which control the proliferation and survival of Burkholderia spp. in the environment (Dance, 2000 (a)).
D. Intentional Releases:
-
Intentional Release information
:
-
Description:
Melioidosis was an important cause of morbidity and mortality in foreign troops fighting in South East Asia. Concerns of re-activation of latent infection in soldiers returned from Vietnam, with estimates from serology studies of ~225,000 potential cases, resulted in melioidosis being called the "Vietnamese time bomb". However, while occasional cases of re-activation of B. pseudomallei still occur in Vietnam veterans, it is rare in comparison to the numbers exposed. Melioidosis remains a risk for travellers to endemic areas, especially if they have a recognised risk factor as discussed below. Adventure tours resulting in extensive exposure to wet season soils and surface water are a possible scenario for infection. This occurred in early 2002 in a young French tourist who died from fulminant melioidosis septicemic pneumonia after exposure to muddy soils on a camping tour of a tropical Australian wilderness park. Imported melioidosis cases are seen each year in hospitals in southern Australia. Some of these cases are acquired in tourists returning from northern Australia and others are acquired in South East Asia. Occasional imported cases are also reported from Europe and the USA. While the vast majority of these cases are from recent acquisition of B. pseudomallei, as occurs with more than 90% of cases in northern Australia, occasional patients may have chronic melioidosis or have re-activation of disease from a latent focus many years after leaving an endemic area, as noted above in returned soldiers from Vietnam (Currie, 2003).
The potential for the bacterium to cause disease after inhalation has also resulted in the inclusion of this pathogen on the Centers for Disease Control list of potential biothreat agents as a Category B agent (Holden et al., 2004).
-
Emergency contact: If you believe that you have been exposed to a biological or chemical agent, or if you believe an intentional biological threat will occur or is occurring, contact your local health department and/or your local police or other law enforcement agency.
III. Infected Hosts
-
Animals:
-
Taxonomy Information:
-
Species:
-
Sheep
:
-
Ontology: UMLS:C0036945
-
GenBank Taxonomy No.:
9938
-
Scientific Name:
Ovis aries musimon (Website 5)
-
Description: Both acute and chronic forms are observed in sheep and goats, the chronic form being more common. The clinical picture of melioidosis in goats and sheep is similar. Experimentally infected sheep develop a severe febrile reaction accompanied by anorexia, lameness and thick, yellow exsudate from the nose and eyes. Naturally and experimentally infected sheep can show evidence of central nervous system (CNS) involvement, including lameness, walking in circles, nystagmus, blindness, hyperaesthesia and mild tetanic convulsions. Pneumonia with respiratory distress can be present. In rams, orchitis with testicular nodules can be seen. The clinical signs observed in goats include fever, anorexia, progressive emaciation, nasal discharge, coughing, salivation, lameness, paresis of the hind legs, severe mastitis, abortion or CNS disorders (Sprague and Neubauer, 2004).
-
Goats
:
-
Bovine, Cattle
:
-
Ontology: UMLS:C1140701
-
GenBank Taxonomy No.:
9913
-
Scientific Name:
Bos taurus (Website 7)
-
Description: Bovine melioidosis is very rare and tends to run a chronic course in adult animals. It concluded that susceptibility to B. pseudomallei in cattle is low but abscess formation may occur from infection. The clinical signs observed in one case were fever, aggressive behaviour, rapid, panting respiration, continuous profuse salivation and staggering gait. The second case developed an acute arthritis after a deep cut developed into a chronic granulating sinus. One case of acute melioidosis in a calf has been described. Some authors postulated that cattle and water buffalo may be immune to B. pseudomallei (Sprague and Neubauer, 2004).
-
Pigs
:
-
Ontology: UMLS:C0039005
-
GenBank Taxonomy No.:
9823
-
Scientific Name:
Sus scrofa (Website 8)
-
Description: The pig is considered to have a high natural resistance to B. pseudomallei. Cases have been reported from Vietnam, Malaysia and Australia. The appearance of lesions is believed to be postponed by the route of infection, as inhalation of aerosols will produce abscess formation in the bronchial region, and ingestion will affect the mandibular lymph nodes. Rarely seen clinical signs include fever, anorexia with progressive emaciation, discharge from nose and eyes, coughing, dyspnoea, uncoordinated gait and diarrhoea. In adult animals the disease tends to run a more chronic course with few clinical signs, whereas in young pigs the disease tends to be acute (Sprague and Neubauer, 2004).
-
Horses
:
-
Ontology: UMLS:C0242616
-
GenBank Taxonomy No.:
9788
-
Scientific Name:
Equidae (Website 9)
-
Description: Melioidosis in horses can manifest itself in various forms: superacute cases with high fever, septicaemia, limb oedema, diarrhoea and death occurring within 24 h, acute cases with limb oedema, slight colic and intestinal hypermotility. In general, however, the course is subacute to chronic, lasting from 3 weeks to 3 months with no loss of appetite. Further symptoms are emaciation, weakness, oedema and lymphangitis of the limbs, mild colic, diarrhoea, pneumonia, cough and nasal discharge. Skin involvement has been reported, initially resembling fungal eczema, which later became papula without abscess formation. Acute meningoencephalitis and keratitis, have been reported. In areas where the infection is acquired mainly per os, intestinal symptoms may predominate (Sprague and Neubauer, 2004).
-
Dogs
:
-
Ontology: UMLS:C0012984
-
GenBank Taxonomy No.:
9615
-
Scientific Name:
Canis familiaris (Website 10)
-
Description: In dogs acute, subacute and chronic melioidosis can be distinguished. The most significant clinical signs in acute cases are fever, severe diarrhoea, fulminant pneumonia and septicaemia. The subacute form can last from 7 days to several months and frequently starts as a skin lesion with development of lymphangitis and lymphadenitis resulting in septicaemia. However, pulmonary involvement with subsequent septicaemia can also be observed. Necrosis and granulomatous inflammation of localized lesions describe the chronic form. Further symptoms are anorexia, myalgia, oedema of the limbs, dermal abscesses and epididymitis (Sprague and Neubauer, 2004).
-
Cats
:
-
Ontology: UMLS:C0007450
-
GenBank Taxonomy No.:
9685
-
Scientific Name:
Felis catus (Website 11)
-
Description: Melioidosis in cats has been described, with abscess formation in the liver, spleen and lymph nodes (Sprague and Neubauer, 2004).
-
Camels, Dromedaries
:
-
Ontology: UMLS:C0013127
-
GenBank Taxonomy No.:
9838
-
Scientific Name:
Camelus dromedarius (Website 12)
-
Description: In camels, the disease tends to run a chronic course and the lung appears to be the preferred site for B. pseudomallei. Camels are usually affected with a hacking cough which is later accompanied by purulent discharge from the nose and respiratory insufficiency. Ataxia of the hind limbs, dehydration, pyrexia and listlessness have also been observed in one case. Prior to its death, the camel showed signs of wasting disease and was severely emaciated. Melioidosis was diagnosed post-mortem (Sprague and Neubauer, 2004).
-
Fallow deers
:
-
Ontology: UMLS:C0325214
-
GenBank Taxonomy No.:
30532
-
Scientific Name:
Cervus dama (Website 14)
-
Description: It was reported an outbreak in fallow deer which had been imported from New Zealand to Malaysia in 1988. The first death occurred 5 days after arrival and approximately two-thirds of the herd died within 8 weeks. Occasionally, sick animals lag behind the herd (Sprague and Neubauer, 2004).
-
:
-
Ontology: UMLS:C0325222
-
GenBank Taxonomy No.:
92867
-
Scientific Name:
Cervus nippon nippon (Website 13)
-
Description: The clinical picture of melioidosis in a Sika deer and its calf is anorexia, weight loss and dry and ruffled hair coat, leading to death within a week (Sprague and Neubauer, 2004)
-
Kangaroo
:
-
Ontology: UMLS:C0022494
-
GenBank Taxonomy No.:
9322
-
Scientific Name:
Macropus sp (Website 15).
-
Description: Melioidosis also occurs in marsupials, such as wallabies, tree-climbing kangaroo and koala. No clinical signs have been reported so far (Sprague and Neubauer, 2004).
-
Tree climbing kangaroo
:
-
Koala
:
-
Ontology: UMLS:C0324717
-
GenBank Taxonomy No.:
38626
-
Scientific Name:
Phascolarctos cinereus (Website 16)
-
African parrot, Grey parrot
:
-
Ontology: UMLS:C0325953
-
GenBank Taxonomy No.:
57247
-
Scientific Name:
Psittacus erithacus (Website 17)
-
Description: Birds are considered to be relatively resistant to B. pseudomallei infection but cases of melioidosis in birds have been reported from Australia, Malaysia. The clinical signs are lethargy, anorexia and diarrhoea leading to death. These birds did not show any change in their systemic condition apart from hyperthermia on the first and third day post-infection (Sprague and Neubauer, 2004).
-
Cockatoo
:
-
Galah
:
-
Whales
:
-
Ontology: UMLS:C0325138
-
GenBank Taxonomy No.:
82174
-
Scientific Name:
Pseudorca crassidens (Website 19)
-
Description:
The number of deaths peaked in the summer months, possibly as a result of contamination of seawater with soil after heavy rain and/or aerosolisation of organisms during high velocity winds (Hicks et al., 2000).
-
Killer whale
:
-
Ontology: UMLS:C0995158
-
GenBank Taxonomy No.:
9733
-
Scientific Name:
Orcinus orca (Website 20)
-
Description:
The number of deaths peaked in the summer months, possibly as a result of contamination of seawater with soil after heavy rain and/or aerosolisation of organisms during high velocity winds (Hicks et al., 2000).
-
Dolphin
:
-
Ontology: UMLS:C0999570
-
GenBank Taxonomy No.:
9739
-
Scientific Name:
Tursiops truncatus (Website 21)
-
Description: Marine mammals, such as dolphin, whale, sea lion and grey seal, are also susceptible to B. pseudomallei, with chronic and acute manifestation. The clinical presentation is mainly that of acute septicaemia. Inappetence, anorexia, listlessness and pyrexia are usually observed a few days preceding death. In contrast to other species, respiratory distress does not seem to be a typical feature. Dolphins suffer from enteritic disease with diarrhoea and formation of liver abscesses (Sprague and Neubauer, 2004).
-
Pacific white-sided dolphin
:
-
Sea lion
:
-
Grey seal
:
-
Primates
:
-
Ontology: UMLS:C0033147
-
GenBank Taxonomy No.:
9443
-
Scientific Name:
Primates (Website 25)
-
Description: Various outbreaks of melioidosis have been described in monkeys. In general, anorexia, wasting, listlessness, intermittent cough, nasal discharge, mild respiratory disease which can lead to acute, fulminating bronchopneumonia and general weakness are reported. Tissue swelling with formation of multiple abscesses are frequently observed. Paralysis and nerve damage are occasionally seen. Cases of melioidotic osteomyelitis have been described in macaque species. A case of intrauterine transmission has been observed in a spider monkey (Brachytelis arachnoides) (Sprague and Neubauer, 2004).
-
Rodents
:
-
Infection Process:
No infection process information is currently available here.
-
Disease Information:
No disease information is currently available here.
-
Prevention:
No prevention information is currently available here.
-
Model System:
No model system information is currently available here.
-
Human:
-
Taxonomy Information:
-
Species:
-
Human
:
-
Ontology: UMLS:C0086418
-
GenBank Taxonomy No.:
9606
-
Scientific Name:
Homo sapiens (Website 4)
-
Infection Process:
-
Infectious Dose:
The LD50 (50% lethal dose) for B. pseudomallei in the Syrian hamster model of acute melioidosis is less than ten organisms (Siritapetawee et al., 2004).
-
Description:
Infection in humans and animals is thought to occur by inoculation, ingestion or inhalation of environmental organisms. Watering of soil in the dry season, e.g. in the surroundings of water pumps or in fields leads to a higher isolation rate and presumably to a higher risk of infection. The number of registered cases of infection increases with rainfall, e.g. during the rainy season in the tropics when it is more likely that animals and humans can come into contact with muddy water and soil particles carrying bacteria from deeper layers to the surface. Animal-to-human transmission has rarely been documented but can result in fatalities as B. pseudomallei has an extremely broad host range (Sprague and Neubauer, 2004).
Disease occurs after bacterial contamination of breaks in the skin or by inhalation after contact with water or soil. A pneumonic form of the disease can also result from the inhalation of contaminated dusts and was reported in U.S. helicopter pilots during the Vietnam War (Holden et al., 2004).
-
Disease Information:
-
Melioidosis
(i.e., Melioidosis)
:
-
Pathogenesis Mechanism:
B. pseudomallei survives inside several eukaryotic cell lines and is seen within phagocytic cells in pathological specimens. After internalisation, it escapes from endocytic vacuoles into the infected cell cytoplasm and then forms membrane protrusions by inducing actin polymerisation at one pole. The actin protrusions from the infected cell membrane mediate spread of the organism from cell to cell. The role of exotoxins in the pathogenesis of melioidosis is unresolved. The high mortality of B. pseudomallei infections is related to an increased propensity to develop high bacteraemias (more than 1 cfu/mL), but the relation between bacterial counts in blood and mortality is similar to that of other gram-negative pathogens. This finding suggests that exotoxins do not contribute directly to outcome. The cell wall lipopolysaccharide (LPS), which is the immunodominant antigen, is highly conserved. High concentrations of antibodies to LPS 2 are associated with improved survival in severe melioidosis. B. pseudomallei produces a highly hydrated glycocalyx polysaccharide capsule, an important virulence determinant that helps to form a slime. This capsule facilitates formation of microcolonies in which the organism is both protected from antibiotic penetration and phenotypically altered, resulting in reduced susceptibility to antibiotics (small colony variants). Passive immunisation with antibody to this exopolysaccharide reduces the lethality of infection in mice. To date, the organisms which cause invasive disease are indistinguishable from those found in the environment (White et al., 2003).
-
Incubation Period:
Incubation period from defined inoculating events was previously ascertained as 1-21 (mean 9) days (Currie et al., 2000 (b)).
In endemic areas, seroepidemiological surveys showed that infection, mostly latent, occurred fairly commonly since childhood as 80% of children had antibodies by the age of four years. However, clinical melioidosis is more common in the elderly which in some cases are due to reactivation of primary latent infection. Since the incubation period of the reactivation can vary from weeks to many years (Leelarasamee, 1998).
-
Prognosis:
While 2036% of melioidosis cases have no evident predisposing risk factor, the vast majority of fatal cases have an identified risk factor, the most important of which are diabetes, alcoholism and chronic renal disease. 46% of cases were bacteraemic and overall mortality was 19%, compared with 60% bacteraemia and 44% mortality in Thailand, and 52% bacteraemia and 46% mortality in Singapore (Currie, 2003).
The mortality rate is below 10% for illness severity that lies between asymptomatic and localized melioidosis. The mortality rate rises sharply from 10% in septicemic melioidosis to 90% in melioidosis with septic shock (Leelarasamee, 2004).
-
Diagnosis Overview:
Melioidosis should be suspected in any severely ill febrile patient with an underlying predisposing condition who lives in, or has travelled from, an endemic area. In northeast Thailand, B. pseudomallei is the most common cause of septicaemic illness during the rainy season in adult diabetics. Evidence of abscess formation is often noted either in the lungs on the chest radiograph, or in the liver and spleen on ultrasound examination. Whereas liver abscess can be caused by Entamoeba histolytica or by enteric bacteria, splenic abscess is much less common, and is more likely than liver abscess to suggest melioidosis in endemic areas; in northeast Thailand 95% of splenic abscesses are caused by B pseudomallei. Up to 13% of patients with septicaemia have subcutaneous abscesses in which gram-negative rods can be detected. Haematological and biochemical findings are similar to those in patients with other causes of bacterial sepsis, although evidence of the underlying predisposing condition (hyperglycaemia or renal impairment) is often noted (White et al., 2003).
-
Symptom Information
:
-
General Description:
The clinical spectrum of melioidosis in Australia is similar to that in Thailand, but there are also some differences. Similarities include the high proportion (50%) of cases presenting as pneumonia, with skin (13%) and soft tissue (4%) abscesses, osteomyelitis or septic arthritis (4%) are also seen frequently. Differences include the frequency of both prostatic abscesses (18% of male cases) and neurological melioidosis (4%) in Australia. Neurological manifestations were also present in two out of six paediatric cases seen recently in northern Australia. Prostatic abscesses have also been reported from Singapore, and pelvic imaging is probably warranted in any male with melioidosis, particularly if their response to treatment is slow. Furthermore, the overall mortality in Australia is considerably lower (19%) than that reported elsewhere. This may partly reflect the earlier presentation of patients in Darwin (only 46% were bacteraemic compared with 62% in north-east Thailand) (Dance, 2002).
-
Syndrome --
Melioidosis acute suppurative parotitis (White et al., 2003):
-
Description:
Melioidosis acute suppurative parotitis is a unique syndrome. In about 10% of cases, parotitis is bilateral. In advanced cases rupture can arise, either to the skin or through the external ear. Management is with antibiotics (initially ceftazidime, followed by oral amoxicillin-clavulanate) and with incision and drainage. Great care should be taken to avoid damaging the facial nerve. Delay in drainage can result in permanent Bell's palsy. The optimum duration of maintenance treatment for suppurative parotitis has not been determined, but generally 8 weeks of treatment is sufficient. These patients do not relapse and the overall outlook is good (White et al., 2003).
-
Observed:
It occurs mainly in children in east Asia (1 % of adult patients with melioidosis, 29% of paediatric patients), with no other evidence of an underlying predisposing condition. The syndrome is unusual in Australia (White et al., 2003).
Symptoms Shown in the Syndrome:
-
Fever (White et al., 2003):
-
Pain (White et al., 2003):
-
Swelling (White et al., 2003):
-
Syndrome --
Brainstem encephalitis (White et al., 2003):
-
Description:
It is now evident that at least some of the cases presenting with classical neurological melioidosis with involvement of brainstem, cerebellum and spinal cord have direct invasion of the CNS. There are many similarities with the animal case reports and animal studies, where extensive cultures and histology often find evidence of the organism in the CNS and where in a single animal there can be a mixed picture of microabscesses and lymphocytic infiltration. The predominant mononuclear pleocytosis in the CSF could be seen to be analogous with CNS tuberculosis, where there is also direct invasion of the CNS with intracellular bacteria. It is therefore quite possible and even probable that the whole spectrum of neurological melioidosis could be due to direct CNS invasion with B. pseudomallei and the accompanying inflammation. However the possibility of toxin-mediated demyelination or nuclear damage is worth pursuing further, given the prominence in some cases of severe peripheral motor weakness and the presence of mononuclear inflammatory cells in addition to microabscesses. Also the nature of bacterial spread within nervous tissue, including the possibility of bacterial travel along nerves and the predilection for brainstem, cerebellum and spinal cord requires study. The majority of neurological melioidosis has been predominantly described from animals and humans in Australia. Indeed the first outbreak in sheep in 1949 included animals with neurological disease and the first human diagnosed in Australia from 1950 had evidence of CNS involvement. Recent molecular studies from the Menzies School of Health Research have shown that in two outbreaks of melioidosis with clonality of organisms on molecular typing, one in goats and one in humans, the same strain in each outbreak has been associated with both neurological disease and other diverse non-neurological presentations. Furthermore, molecular typing of isolates from CNS melioidosis cases from different locations in the Top End has shown no relatedness between strains. This suggests that CNS melioidosis is unlikely to be due to a specific strain. Whether the relatively high proportion of CNS melioidosis in Australia represents just increased ascertainment or whether there are truly regional differences in clinical aspects of melioidosis related to organism differences or even host factors requires further prospective studies and collaborative evaluation (Currie et al., 2000 (c)).
The pathogenesis is uncertain, but new evidence suggests that multiple focal microabscesses in the brainstem and spinal cord are the cause. Antibiotic treatment is similar to that given for other forms of melioidosis (White et al., 2003).
-
Observed:
In about 4% of cases from Australia and rarely elsewhere, melioidosis presents as brainstem encephalitis with peripheral motor weakness or flaccid paraparesis (White et al., 2003).
Symptoms Shown in the Syndrome:
-
Weakness of limb (White et al., 2003):
-
Cerebellar signs (White et al., 2003):
-
Cranial nerve palsies (White et al., 2003):
-
Syndrome --
Pulmonary melioidosis (Currie, 2003):
-
Description:
This form develops usually after inhalation or through haematogenous spread of the bacteria. This could be the major form of the disease in a bioterrorist attack. When bacteria are aerosolised, they enter the respiratory tract and pulmonary infection may develop, manifested by pneumonia, pulmonary abscesses and pleural effusion. In cases of inhalational melioidosis, cutaneous abscesses may also develop and take months to appear. Without specific treatment, the disease progresses and results in bacteraemia and septicaemia. Patients with cystic fibrosis are prone to developing the pulmonary form of the disease (Bossi et al., 2004).
Acute melioidosis pneumonia has a spectrum from fulminant septic shock (mortality 84% in the Darwin study) to mild undifferentiated pneumonia, which can be acute or subacute in nature, both with little mortality. Septicaemic patients present as acutely unwell with high fevers and prostration and often little initial cough or pleuritic pain. There may also be multiple abscesses in abdominal organs. On chestradiography they often have diffuse nodular infiltrates throughout both lungs, which coalesce, cavitate and progress rapidly, consistent with the caseous necrosis and multiple metastatic abscess formation seen at autopsy. However, some septicaemic pneumonia patients have a more predominant cough with productive sputum, dyspnoea and chest radiography showing discrete but progressive consolidation in one or more lobes. Acute pneumonia with upper lobe consolidation in endemic regions warrants consideration of melioidosis. While such upper lobe disease has predominated in some reports, lower lobe infiltrates were more common overall in non-septicaemic acute and subacute melioidosis from one study. Pleural effusions have generally been uncommon in acute melioidosis, but effusions and empyema can still occur, especially with lower lobe disease. Patients with chronic pulmonary melioidosis have fevers, weight loss and a productive cough, sometimes with haemoptysis. Pleuritic chest pain occurs in half. Disease is often slowly progressive over months. It can also be remitting and relapsing over many years, but acute deterioration with septicaemia may also occur. Classically upper lobe changes with infiltrates and/or cavitation are seen on chest radiography, being present in 37 out of 39 (95%) chronic cases in one study. Initial chest radiography showed cavitary disease with or without infiltrates in 27 out of 39 (69%) and infiltrates in 12 out of 39 (31%). Pleural effusions were present in two out of 39, hilar adenopathy in only one out of 39 and only three out of 39 had bilateral disease. The cavities are usually single and thin walled and rarely contain an air-fluid level. Computed tomography (CT) scan may show small cavities not evident on chest radiography. There are numerous reports of chronic melioidosis being initially misdiagnosed as tuberculosis (Currie, 2003).
The incubation period is 10-14 days. Ulcerative lesions and nodules of the nasal cavity may be present, where in some cases, the septum may perforate. Chest radiography may show a bilateral bronchopneumonia, miliary nodules (0.5 -1 cm), small multiple lung abscesses involving upper lungs, segmental or lobar infiltrates and cavitating lesions, which are often mistaken for tuberculosis (Bossi et al., 2004).
Symptoms Shown in the Syndrome:
-
Fever (Currie, 2003):
-
Prostration (Currie, 2003):
-
Cough (Currie, 2003):
-
Pleuritic pain (Currie, 2003):
-
Weight loss (Currie, 2003):
-
Haemoptysis (Currie, 2003):
-
Syndrome --
Localised infection (Bossi et al., 2004):
-
Description:
Bacteria usually enter the skin through a cut or abrasion. Besides skin abscesses, other well-described forms include ostemyelitis, septic arthritis, brain abscess or visceral abscesses. Parotid abscesses are common in children with melioidosis. Cases of severe urticaria have been reported during primary melioidosis (Bossi et al., 2004).
A localised infection with nodules and ulceration develops within 1 to 5 days at the site where the bacteria entered the body (Bossi et al., 2004).
Symptoms Shown in the Syndrome:
-
Nodules (Bossi et al., 2004):
-
Description:
The nodules are grey or white and firm, surrounded by a haemorrhagic zone, and may caseate or become calcified (Bossi et al., 2004).
-
Lymph nodes:
-
Mucous membrane (Bossi et al., 2004):
-
Description:
Infections involving the mucous membranes in the eyes, nose and respiratory tract will cause increased mucus production from the affected sites (Bossi et al., 2004).
-
Syndrome --
Septicaemia (Bossi et al., 2004):
-
Description:
Overwhelming infection may occur after exposure to the bacteria via any route of infection (inhalation, skin, ingestion etc). Flushing, cyanosis and a disseminated pustular eruption with regional lymphadenopathy, cellulitis or lymphangitis can be seen together with photophobia, lacrimation, cervical adenopathy, mild hepatomegaly and/or splenomegaly, tachycardia, generalised erythroderma, jaundice and generalised papular or pustular lesions. Then a multi-organ failure may occur. Despite antibiotic treatment, the mortality rate is still near 50% (more than 90% without antibiotics, 24-48 hours after onset). Immunosuppressed patients (diabetics, chronic renal patients and patients on steroids) are especially susceptible to melioidosis (Bossi et al., 2004).
Incubation period of 1 to 5 days. Septicaemia is fatal within 7 to 10 days (24-48 hours after the onset of the generalised symptoms) (Bossi et al., 2004).
Symptoms Shown in the Syndrome:
-
Fever (Bossi et al., 2004):
-
Myalgias (Bossi et al., 2004):
-
Headache (Bossi et al., 2004):
-
Diarrhoea (Bossi et al., 2004):
-
Photophobia (Bossi et al., 2004):
-
Cyanosis (Bossi et al., 2004):
-
Flushing (Bossi et al., 2004):
-
Hepatomegaly (Bossi et al., 2004):
-
Splenomegaly (Bossi et al., 2004):
-
Tachycardia (Bossi et al., 2004):
-
Jaundice (Bossi et al., 2004):
-
Syndrome --
Chronic infections (Bossi et al., 2004):
-
Description:
The chronic form of illness involves multiple abscesses within the skin, the muscles of the arms and legs or in the spleen and liver (Bossi et al., 2004).
-
Observed:
Melioidosis, in addition to this chronic form, can become reactive many years after a primary infection (Bossi et al., 2004).
-
Treatment Information:
-
Antibiotic Ceftazidime (White et al., 2003):
Melioidosis is difficult to treat, and response to treatment is often disappointingly slow despite administration of high dose parenteral antibiotics. The antibiotic of choice is ceftazidime. Ceftazidime 40 mg/kg intravenous injection every 8 h, total 120 mg/kg per day or 19 mg/kg intravenous immediately, followed by a continuous infusion of 3-5 mg/kg per h. Parenteral treatment should be given for at least 10 days, and should continue until clear improvement is noted and the patient can take oral drugs (White et al., 2003).
-
Success Rate:
Ceftazidime was associated with a 50% lower overall mortality in severe melioidosis (Currie, 2003)
-
Drug Resistance:
Resistance to many [beta]-lactams and [beta]-lactamase inhibitors is emerging. The genome sequencing of B. pseudomallei revealed the presence of class A, C and D [beta]-lactamase genes. The co-ordination of [beta]-lactamase expression contributes to the resistance to ceftazidime and carbapenem (Leelarasamee, 2004).
-
Antibiotic Imipenem (White et al., 2003):
This antibiotic was one of the most active antibiotics tested. This has been observed previously in a study involving 211 clinical strains, and is of interest because this antibiotic is considered as a good alternative to ceftazidime in the treatment of disseminated disease. It has been recommended by the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of suspected or confirmed melioidosis (Thibault et al., 2004).
Imipenem 20 mg/kg intravenous injection every 8 hf; total 60 mg/kg per day. Meropenem is used in northern Australia, and, although no randomised trials have been done with this antibiotic, it is probably equivalent to imipenem (White et al., 2003).
-
Success Rate:
All the isolates were susceptible to imipenem (Thibault et al., 2004).
-
Drug Resistance:
The two carbapenems available in Australia (imipenem and meropenem) consistently show excellent activity against B. pseudomallei (none of the isolates tested at RDH have been resistant in vitro). This activity persists even in isolates where there is extended small beta, lactam resistance (Jenney et al., 2001).
-
Antibiotics Meropenem-Cotrimoxazole (Dance, 2002):
Meropenem plus cotrimoxazole was used as first choice treatment (Dance, 2002).
-
Success Rate:
Only 16 out of 126 patients died, and latterly six patients with septic shock, a condition previously associated with a mortality rate of 95% (Dance, 2002).
-
Drug Resistance:
Cotrimoxazole. MIC50 - 8/152 mg/L, MIC90 -16/304 mg/L. Resistence - 68% (Thibault et al., 2004).
-
Antibiotics Ceftazidime-Trimethoprim-Sulphamethoxazole (White et al., 2003):
Ceftazidime-Trimethoprim-Sulphamethoxazole antibiotic doses 100+8+40 mg/kg per day. Duration 10-14 days (White et al., 2003).
-
Success Rate:
Mortality rate of 18.5% (White et al., 2003).
-
Drug Resistance:
In a large series from Thailand nine (7%) of 127 patients had B. pseudomallei isolates that developed choramphenicol resistance while taking antibiotics (six were definitely taking chloramphenicol itself and the other three may well have been). These isolates frequently showed cross-resistance to trimethoprim-sulphamethoxazole, tetracyclines and ciprofloxacin (Jenney et al., 2001).
-
Oral Treatment (White et al., 2003):
Adults: Treatment of choice is a four-drug combination of: Chloramphenicol (40 mg/kg per day in four divided doses), Doxycycline (4 mg/kg per day in two divided doses), Trimethoprim-sulfamethoxazole (10 mg and 50 mg/kg per day, respectively, in two divided doses). Children 8 years and pregnant women: Amoxicillin-clavulanate (amoxicillin 30 mg/kg per day, clavulanic acid 15 mg/kg per day) plus amoxicillin (30 mg/kg per day). Oral treatment should be given to complete 20 weeks of treatment. With the four-drug combination, chloramphenicol is given only for the first 8 weeks (White et al., 2003).
-
Drug Resistance:
From a prospective melioidosis study commencing in 1989 at Royal Darwin Hospital, 170 initial isolates of Burkholderia pseudomallei were available for susceptibility testing. Of these 163 (96%) were susceptible to meropenem/imipenem, ceftazidime, trimethoprim-sulphamethoxazole (SMX/TMP) and doxycycline. Seven (4%) showed primary resistance; three had low-level resistance to SMX/TMP, one to ceftriaxone and amoxycillin/clavulanate (AMOX/CA) and three to doxycycline. Of 167 patients who survived their initial presentation, seven (4%) had culture positive infections which persisted for greater than 3 months after start of therapy. All ultimately cleared carriage of B. pseudomallei though three required changing to SMX/TMP after development of doxycycline resistance. Nineteen (11%) of the initial survivors clinically relapsed and 17 of these had repeat isolates available for testing. Four of these had acquired resistance: one to doxycycline, one to AMOX/CA and ceftazidime, one to SMX/TMP and one to both SMX/TMP and doxycycline (Jenney et al., 2001).
-
Prevention:
-
Vaccination:
-
Ontology: UMLS:C0042196
-
Description:
A licensed animal or human vaccine does not exist. However, there are some promising data on the possibility of developing such a vaccine in the future. In a mouse model an attenuated mutant of B. pseudomallei auxothrophic for branched amino acids due to an interruption of the ilvI gene was protective. Various other B. pseudomallei mutants failed to protect laboratory animals. A live vaccine is favoured, as human patients suffering from melioidosis show a cell mediated immune response (lymphocyte proliferation, interleukin production, increase of CD4+ and CD8+ cells), which may be essential for survival, as IgG content is not predictive for disease outcome. Cross-protection using a live tularaemia vaccine to protect against B. pseudomallei has been suggested and needs to be investigated in the future. In order to develop a subunit vaccine, the O-polysaccharide moiety of the lipopolysaccharide was covalently linked to flagellin protein. When this was used to immunize diabetic mice a clear rate of protection was achieved. In fact, in human patients, the amount of anti-LPS II antibodies is positively correlated with survival. Passive protection has been achieved with mouse monoclonal anti-EPS, anti-LPS or anti-protein antibodies when challenged with low infection doses of virulent B. pseudomallei in mice. However, when a higher dose of 1 x 106 colony-forming units (cfu) was applied, none of the antibodies was protective. The anti-EPS antibody was able to significantly prolong the time until death. However, no data are available as to whether total or partial immunity may result in a higher rate of subclinical chronic infection, and regarding what might happen when the 'protected' subject becomes immunocompromised. Research in this field has to be evaluated very carefully (Sprague and Neubauer, 2004).
-
Hygiene:
-
Ontology: UMLS:C0042196
-
Description:
Water hygiene is the predominant requirement in endemic areas where animals for human consumption are bred according to modern practice. The keeping of porkers without access to soil by rearing them on artificial, hard surfaces could not prevent infection. In some cases, the chlorination (2-6 mg/l) of water supplies interrupted the chain of infection effectively if the pH was kept at 6-7 prior to chlorination. If possible, infected animals should be removed from the contaminating source. Moreover, B. pseudomallei seems to profit from modern agricultural practices and animal mass production involving the habitual use of enormous amounts of water. Accordingly, strict control of sewage disposal is imperative in order to prevent the spread of B. pseudomallei. Infected carcasses of animals intended for human consumption have to be condemned and destroyed. The use of gloves and disinfection of contaminated knives is recommended to prevent transmission during the processing of meat. As milk from goats and dairy cows can contain B. pseudomallei pasteurization is recommended. It is noteworthy to mention, that there seem to be no reservations against treatment of pet animals such as cats in areas where melioidosis is endemic. For disinfection, the regular use of potassium hypochlorite and cresol solutions is recommended. The faeces of infected animals have to be removed several times a day. Abundant quantities of water have to be avoided or disinfected immediately. The hooves and lower legs as well as the surfaces of the stables have to be disinfected. Food and water must be given as aseptically as possible. However, no advice on the handling of manure or waste water or regarding rodent control was given. Strict control of the movement of infected animals has also been proposed. In non-endemic areas, infected animals must be culled. This countermeasure is justified for the following reasons: 1. The bacterium needs a subclinically infected carrier animal in order to survive in regions with adverse climate. 2. The organism is resistant to antibiotics. 3. There is the possibility of animal-to-human transmission. These reasons also apply to diseased animals not intended for human consumption. Exotic and rare animals but also 'pet' horses can pose a risk for fatal human infections. Animal transport, human migration and increased travel activity to 'exotic' countries could lead to an increased number of subclinically infected carriers. Their role, but also that of contaminated agricultural products from endemic regions, e.g. manure, may have to be reconsidered. Global warming will result in warmer climates, thereby possibly increasing the spread of B. pseudomallei to new geographic areas, which will then provide ambient environment for its survival. Public health countermeasures of now in effect cannot prevent importation of a saprophyte. In this context, the recent report on the isolation of B. pseudomallei in 7% of tested water resources in Bologna, northern Italy is a disquieting fact (Sprague and Neubauer, 2004).
-
Quicklime - bactericidal inhibitor of B. pseudomallei in soil:
-
Ontology: UMLS:C0064990
-
Description:
Successful treatment of melioidosis has been difficult due to the lack of effective drugs and the inherent resistance of B. pseudomallei to various groups of antibiotics, including b-lactams, aminoglycosides, macrolides and polymyxins (Siritapetawee et al., 2004).
Measurement of in vitro activity of quicklime (calcium oxide) against Burkholderia pseudomallei revealed that quicklime at concentrations of 10% or more was bactericidal for up to 35 d. The effect of quicklime as an inhibitor of B. pseudomallei in soil from a rice field was studied in a laboratory setting. The soil, collected from a rice field in north-eastern Thailand, was mixed with B. pseudomallei. In experiment 1, quicklime was mixed with the soil in different amounts. In experiment 2, quicklime was spread over the soil surface. In experiment 3, quicklime solution was poured onto the soil. It was found that the pH of the soil in experiment 1 was much higher than that in experiments 2 and 3. Only quicklime mixed with soil at a concentration of 40% or more (weight/weight) was effective in inhibiting the growth of B. pseudomallei for up to six weeks (Na-ngam et al., 2004).
-
Model System:
-
Swiss Mice:
-
Ontology: UMLS:C0162416
-
Model Host:
-
Description:
Female Swiss mice. For all experiments, animals were used when they were 8 weeks old. The numbers of viable bacteria in the dilutions used were determined by plate counting. To establish the 50% lethal dose (LD50), groups of six mice were inoculated with 200-l aliquots of the various dilutions via the intraperitoneal or subcutaneous route or with 50-l aliquots via the intranasal route. Death was recorded over the following 6 weeks (Valade et al., 2004).
-
BALB/c Mice:
-
Ontology: UMLS:C0025919
-
Model Host:
-
Description:
This study investigated the role of the Bsa type III secretion system in the pathogenesis of melioidosis in murine models. For each infection, aliquots of B. pseudomallei wild-type or mutant strains were thawed from frozen stocks. Bacterial cells were diluted in PBS to the required concentration and administered either via the intraperitoneal route (02 ml) or via the intranasal route (005 ml), and mice were then monitored twice daily for symptoms of infection. Viable count determinations were performed to confirm the inoculation dose. Median lethal doses (MLDs) were determined by the method of Reed, Muench (1938). To enumerate bacteria in the liver and spleen, the organs were aseptically removed and homogenized in sterile PBS by passing them through a 100 m mesh cell-strainer. Serial tenfold dilutions of tissue homogenates were plated onto tryptone soy agar, and colonies were enumerated after 24 h (Stevens et al., 2004).
Characterization of a murine model of melioidosis. After intravenous infection with B. pseudomallei, C57BL/6 mice were found to be significantly more resistant than BALB/c mice.There was a marked organotropism of B. pseudomallei for the spleen and liver in both strains of mice, with the highest bacterial load in the spleen. Electron microscopic investigations of the spleen clearly demonstrated intracellular replication within membrane-bound phagosomes. Electron micrographs of the liver provided evidence that B. pseudomallei-containing phagosomes in hepatocytes fuse with lysosomes, leading to degradation of bacteria. In both strains of mice, the course of infection was highly dependent on the infective dose and the bacterial strain used, ranging from death within a few days to death after several weeks. In comparison with BALB/c mice, the bacterial counts in C57BL/6 mice were decreased 12 h after infection, which is suggestive of an innate immune mechanism against B. pseudomallei in this early phase of infection contributing to the lower susceptibility of C57BL/6 mice. BALB/c mice developed a more pronounced lymphopenia, granulocytosis, and splenomegaly at a lower infective dose compared to C57BL/6 mice. Analysis of the antibody response against B. pseudomallei 11 days after infection revealed a significantly higher immunoglobulin G2A (IgG2a)/IgG1 ratio in C57BL/6 mice than in BALB/c mice, indicating that a T helper type 1 immune response is associated with resistance to infection with B. pseudomallei (Hoppe et al., 1999).
G-CSF immunotherapy for treatment of acute disseminated murine melioidosis. It has been proposed that adjunctive immunotherapy using granulocyte colony stimulating factor (G-CSF) combined with antibiotics may provide an alternative approach to antibiotics alone. It was developed a murine model for melioidosis that allows novel treatment approaches to be investigated. This study looked at the potential for murine G-CSF therapy both alone and as an adjunct in the treatment of acute disseminated B. pseudomallei infection in BALB/c mice. A number of therapeutic variables involving ceftazidime and recombinant murine G-CSF were studied. Surviving mice were sacrificed and splenic bacterial loads were determined. Combining recombinant murine G-CSF with ceftazidime offered no advantage over ceftazidime alone. Pre-treatment with recombinant murine G-CSF did not demonstrate a significant benefit. This would suggest that adjunct immunotherapy using G-CSF is of limited benefit (Powell et al., 2003).
Biodefense-driven murine model of pneumonic melioidosis. A whole-body mouse model of pneumonic melioidosis was established for future evaluation of biodefense vaccine candidates. The aerosol 50% lethal doses of Burkholderia pseudomallei strain 1026b for BALB/c and C57BL/6 mice and the times to death, dissemination in organs, and tissue loads after exposure of the mice to low- and high-dose aerosols are reported. In addition, rpsL mutant backgrounds were attenuated in this acute model of disease (Jeddeloh et al., 2003).
Little is known about the CpG-induced protection against acute fatal sepsis such as that associated with the highly virulent bacterium Burkholderia pseudomallei. In the present study, CpG ODN 1826 given intramuscularly to BALB/c mice 2 to 10 days prior to B. pseudomallei challenge conferred better than 90% protection. CpG ODN 1826 given 2 days before the bacterial challenge rapidly enhanced the innate immunity of these animals, judging from the elevated serum levels of interleukin-12 (IL-12)p70 and gamma interferon (IFN-gamma) over the baseline values. No bacteremia was detected on day 2 in 85 to 90% of the CpG-treated animals, whereas more than 80% of the untreated animals exhibited heavy bacterial loads. Taken together, the kinetics of bacteremia and cytokine profiles presented are compatible with the possibility that protection by CpG ODN 1826 against acute fatal septicemic melioidosis in this animal model is associated with a reduction of bacterial load and interference with the potential detrimental effect of the robust production of proinflammatory cytokines associated with B. pseudomallei multiplication (Wongratanacheewin et al., 2004).
-
Syrian Hamsters:
-
Ontology: UMLS:C0018561
-
Model Host:
-
Description:
The animal model of acute B. pseudomallei infection. Bacteria were grown overnight. The OD600 values were determined, and the cultures were adjusted to an OD600 of approximately 0.55 (5 x 108 CFU/ml). Serial dilutions of the cultures were prepared in sterile PBS, and female hamsters 6 to 8 weeks old were inoculated intraperitoneally with 100 l of bacteria corresponding to inoculum sizes of 10, 50, 100, and 1,000 CFU. After 48 h, the 50% lethal dose (LD50) values were calculated (Moore et al., 2004).
IV. Labwork Information
A. Biosafety Information:
-
Biosafety information for
:
Burkholderia pseudomallei
:
-
Biosafety Level:
Biosafety level (BSL) 2 practices, equipment, and containment are recommended for working with known or potentially infectious body fluids, tissue specimens, or cultures. However, a review of work in a clinical laboratory in an area in which melioidosis is endemic indicated low risk to laboratory workers (CDC Report, 2004).
B. Culturing Information:
-
Ashdown's selective agar
(Ashdown, 1979):
-
Description:
Definitive diagnosis of melioidosis requires a positive culture of B. pseudomallei. Melioidosis must be considered in febrile patients in or returning from endemic regions to enable appropriate samples and laboratory awareness. B.pseudomallei readily grows in commercially available blood culture media but it is not unusual for laboratories in nonendemic locations to misidentify the bacteria. Culture from nonsterile sites can be problematic and the likelihood of successful culture is increased if sputum, throat swabs, ulcer/skin lesion swabs and rectal swabs are placed into Ashdown's medium, a gentamicin-containing liquid transport broth that results in selective growth of B. pseudomallei (Currie, 2003).
Ashdown's selective agar (ASA). Ashdown's selective agar (ASA) is the currently favored medium for the isolation and presumptive identification of B. pseudomallei in areas where melioidosis is endemic (Howard and Inglis, 2003).
-
Medium:
-
A selective medium consisting of trypticase soy agar with 4% glycerol, 5 mg/l crystal violet, 50 mg/l neutral red and 4 mg/l of gentamicin was devised for isolation of Pseudomonas pseudomallei from clinical specimens. Absorption of neutral red was found to be suitable for differentiating this organism from other bacteria, while gentamicin was effective in selecting Ps. pseudomallei from organisms commonly found in clinical material. The medium was more suitable for screening clinical specimens than MacConkey's agar with colistin-S because it was more selective and allowed multiple specimens to be inoculated on a single plate (Ashdown, 1979).
-
Optimal Temperature:
35C (Howard and Inglis, 2003)
-
Novel Burkholderia pseudomallei selective agar (BPSA)
(Howard and Inglis, 2003):
-
Description:
Isolation of Burkholderia pseudomallei currently relies on the use of Ashdown's selective agar (ASA). It was designed a new selective agar (Burkholderia pseudomallei selective agar [BPSA]) to improve recovery of the more easily inhibited strains of B. pseudomallei. B. pseudomallei, Burkholderia cepacia, and Pseudomonas aeruginosa were used to determine the selectivity and sensitivity of BPSA. BPSA was more inhibitory to P. aeruginosa and B. cepacia and should make recognition of Burkholderia species easier due to distinctive colony morphology. BPSA also inhibited Enterococcus, Escherichia, Staphylococcus, and Streptococcus: These results indicate that BPSA is a potential replacement for ASA. BPSA provides large wrinkled colonies faster than ASA. This means that B. pseudomallei colonies are more visible and there is more bacterial growth for supplementary tests. This is particularly important for melioidosis, for public health control strategies that rely on rapid isolation of B. pseudomallei will also benefit from faster detection. This time reduction should also improve the quality of antibiotic treatment for patients. While public health investigations of melioidosis are hampered at present by delays in isolation of B. pseudomallei from nonsterile clinical sites, isolation of B. pseudomallei from environmental specimens such as soil and water takes even longer (Howard and Inglis, 2003).
-
Medium:
-
BPSA PREPARATION. BPSA comprised 23.5 g of SMA (BBL, Cockeysville, Md.), 4 g of maltose (Sigma, St. Louis, Mo.), and 100 mg of neutral red (Sigma) in 1 liter of distilled water sterilized at 134C for 10 min (or 121C for 15 min). The agar Is allowed to cool to 40 to 45C, and then 20 mg of gentamicin (Sigma) per liter and 1 ml of 20-g/liter Nile blue (dissolved in 1% dimethyl sulfoxide) are added after filter sterilization via a 0.2-m-pore-size membrane (Pall Corporation, Ann Arbor, Mich.). Ten milliliters of glycerol (equivalent to 1%) (BDH, Merck P/L, Kilsyth, Australia) is added and the medium is placed onto a heated magnetic stirrer at 40C for 5 min before plates are poured (18 ml/plate) (Howard and Inglis, 2003).
-
Optimal Temperature:
35C (Howard and Inglis, 2003)
C. Diagnostic Tests
:
-
Organism Detection Tests:
-
Rapid immunofluorescence microscopy (IF) (Wuthiekanun et al., 2005):
-
Ontology:
UMLS: C0079604
-
Time to Perform:
minutes-to-1-hour
-
Description:
The rapid method was a one-step technique in which 1 drop (10 l) of specimen was mixed on a clean glass microscopic slide with an equal volume of conjugate and a coverslip applied. The white blood cells present in pus were lysed prior to examination by the addition of an equal volume of distilled water, and respiratory secretions were mixed with an equal volume of sterile distilled water before examination. Conjugate was used at a 1:200 dilution in blocking buffer. The slides were examined with a fluorescent microscope with a x100 oil-immersion lens. A positive result by either test was recorded when the periphery of the bacilli showed a strong apple-green fluorescence. A slide known to be positive (for a clinical isolate of B. pseudomallei) was prepared and examined in each test run. The results of this rapid method and those of an existing IF method were prospectively compared with the culture results for 776 specimens from patients with suspected melioidosis. The sensitivities of both IF tests were 66%, and the specificities were 99.5 and 99.4%, respectively (Wuthiekanun et al., 2005).
-
False Positive:
Four of the 622 specimens (from 526 patients) that were culture negative for B. pseudomallei were positive by either IF method. Three were false positive by both methods, and an additional sample was false positive only by the standard IF method. Two of these were urine samples that grew Pseudomonas aeruginosa and Acinetobacter spp., respectively, on Ashdown's medium; and two were respiratory secretions that were negative on Ashdown's medium but that grew mixed respiratory flora on blood agar (Wuthiekanun et al., 2005).
-
Immunoassay Tests:
-
ELISA:
-
Ontology:
UMLS:C0014441
-
Description:
An enzyme-linked immunosorbent assay (ELISA) for antibodies to a partly purified culture filtrate antigen. The immunoglobulin G ELISA exhibited a sensitivity of 96% and a specificity of 97%, whereas the immunoglobulin M ELISA had a sensitivity of 74% and a specificity of 99%. The responses were studied in more detail in a smaller group of patients. Immunoglobulin G was detectable in 96-100% of patients with proved or suspected melioidosis, immunoglobulin A was detectable in 86-100%, and immunoglobulin M in 66-85%, whereas immunoglobulin E was not detected. A higher proportion of cases with localized than with septicaemic infections were antibody positive. Immunoglobulin G1 and G2 were the predominant subclasses detected. However, an internationally standardized serodiagnostic test for melioidosis is much needed (Dance, 2002).
It can be assumed that all tests described so far cross-react with antibodies raised against B. mallei. Despite all these shortcomings, serology has always been used in veterinary medicine for the identification of anti-Burkholderia antibodies, e.g. in horses, goats and dairy cows. To date, none of the newly developed tests has been or is commercially available and no positive and negative control sera of the various animal species which could be infected with B. pseudomallei are available. Serology is still a technique restricted to a limited number of expert laboratories worldwide. In view of the international transport of animals from endemic to non-endemic areas, the development of a sensitive and specific serological test is unavoidable in order to prevent the spread of B. pseudomallei in the future (Sprague and Neubauer, 2004).
-
Monoclonal antibody-based latex agglutination:
-
Ontology:
UMLS:C0023117
-
Description:
A monoclonal antibody-based latex agglutination (MAb-LA) test was employed for the rapid identification of Burkholderia pseudomallei in blood culture fluid from patients with community-acquired septicaemia. These patients were admitted to 12 hospitals in the northeastern part of Thailand which is a region known to be endemic for melioidosis. Blood samples were collected and immediately added to the blood culture bottles which were incubated in either automated (five hospitals) or manual (seven hospitals) culture systems. Of a total of 1369 culture-positive specimens, 204 specimens were culture-positive for B. pseudomallei. Of those, 194 (95%) were positive by MAb-LA and the type of blood culture system did not affect positivity rates. The performance of the MAb-LA test on these specimens was highly satisfactory compared with culture detection and confirmation by biochemical test, with 95.1% sensitivity, 99.7% specificity and 98.8% and 99.2% for positive and negative predictive values, respectively. The method described is highly reproducible, simple to perform even by inexperienced laboratory personnel and does not require expensive or elaborate equipment (Anuntagool et al., 2000).
-
Lipopolysaccharide-specific monoclonal antibody:
-
Ontology:
UMLS:C0023117
-
Description:
The Bps-L1 monoclonal antibody recognized the lipopolysaccharide antigen of 96.8% of B. pseudomallei clinical isolates and was highly specific for B. pseudomallei. The diagnostic value of the latex agglutination test based on Bps-L1 monoclonal antibody was prospectively evaluated in an area endemic for melioidosis. The agglutination test kit was evaluated in 88 blood cultures with gram-negative bacteria identified with Gram staining. The sensitivity and specificity of the test kit were both 100%. These results indicated that the detection of B. pseudomallei lipopolysaccharide by specific monoclonal antibody in a latex agglutination format is clinically useful for the rapid identification of the bacteria in blood cultures in areas endemic for melioidosis (Dharakul et al., 1999).
-
Monoclonal antibody (MAb) specific to the 30-kDa protein of B. pseudomallei :
-
Ontology:
UMLS:C0023117
-
Description:
The definitive diagnosis of this disease is made by bacterial culture. In this study, it was produced a monoclonal antibody (MAb) specific to the 30-kDa protein of B. pseudomallei by in vivo and in vitro immunization of BALB/c mice with a crude culture filtrate antigen. The MAb could directly agglutinate with all 243 clinical isolates of B. pseudomallei but not with other gram-negative bacteria, except for one strain of Burkholderia mallei. However, the MAb cross-reacted with the gram-positive Bacillus sp. and Streptococcus pyogenes. B. pseudomallei in brain heart infusion broth (BHIB) subcultured from a BacT/Alert automated blood culture system could be identified by simple agglutination with this MAb assay. The sensitivity and specificity of direct agglutination compared to the "gold standard," the culture method, were 94.12 and 98.25%, respectively. However, the MAb adsorbed to polystyrene beads or latex particles directly identified the bacterium in blood culture specimens and in BHIB subcultured from a BacT/Alert automated blood culture system. The sensitivity of the latex agglutination test was 100% for both blood culture and BHIB specimens. The specificity was 85.96 and 96.49% for the blood culture and BHIB specimens, respectively. The specificity could be increased if the nonspecific materials in the blood culture broths were eradicated by centrifugation at low speeds. Thus, a combination of blood culture and the agglutination method could be used for the rapid diagnosis of melioidosis in the routine bacteriological laboratory. This method could speed up detection of the bacterium in blood culture by at least 2 days, compared to the conventional bacterial culture method. In addition, the MAb is stable at room temperature for 2 weeks and at 4, -20, and -70 degrees C for at least 1 year. The latex reagent was stable for at least 6 months at 4 degrees C (Pongsunk et al., 1999).
-
Monoclonal antibody specific for exopolysaccharide of B. pseudomallei:
-
Ontology:
UMLS:C0023117
-
Description:
In this study it was developed a latex agglutination test based on monoclonal antibody 3015, which is specific for this exopolysaccharide, and evaluated this test for rapid identification of B. pseudomallei grown on agar plates. All 74 environmental and clinical B. pseudomallei strains tested, originating from different areas of Southeast Asia, northern Australia, and Africa, showed a strong and specific agglutination. B. pseudomallei-like organisms and a variety of other bacteria did not react. In conclusion this monoclonal antibody-based test is a simple, rapid, and highly specific method for identifying B. pseudomallei culture isolates from different geographic areas (Steinmetz et al., 1999).
-
Nucleic Acid Detection Tests:
:
-
Multiplex PCR:
-
Ontology:
UMLS:C0032520
-
Description:
The multiplex PCR consists of primers that flank a 10-bp repetitive element in B. pseudomallei and B. mallei amplifying PCR fragment of varying sizes between 400700 bp, a unique sequence in B. thailandensis amplifying a PCR fragment of 308 bp and the metalloprotease gene amplifying a PCR fragment of 245 bp in B. pseudomallei and B. thailandensis. The multiplex PCR not only can differentiate the three Burkholderia species but can also be used for epidemiological typing of B. pseudomallei and B. mallei strains (Lee et al., 2005).
-
Primers:
-
Pair of primers
-
Forward:
SR1: 5 ACC GCG TAT GAA GGG ATG TC 3; SRT3: 5 AAA GCT GCG CGC TCG GCA TC 3 (Lee et al., 2005)
-
Reverse:
SR5: 5 ACG CGC ACG CAC CTG CTG AAC 3 (Lee et al., 2005)
-
Product
-
Real-time PCR assays:
-
Description:
It was established real-time PCR assays using fluorescent hybridization probes targeting the 16S rDNA, the flagellin C (fliC) and the ribosomal protein subunit S21 (rpsU) genes. The test sensitivity and specificity were assessed with a representative panel of 39 B. pseudomallei, 9 B. mallei, 126 other Burkholderia strains of 29 species, and 45 clinically relevant non-Burkholderia organisms. The detection limit for the 16S rDNA, fliC, and rpsU assay was 40, 40, and 400 genome equivalents per reaction, however, in spiked blood samples it was 300, 300, and 3000, respectively. Specificity, positive and negative predictive value of the assays was 100%. In conclusion, it was recommend the use of the 16S rDNA and/or fliC real-time PCR assays for the rapid identification of B. mallei and B. pseudomallei in positive blood cultures or from suspicious bacterial colonies (Tomaso et al., 2005).
-
Primers:
-
Target :16S rDNA
-
Forward:
Burk 16S: TTCTGGCTAATACCCGGAGT (426445) (Tomaso et al., 2005)
-
Reverse:
Burk 16S R: GCCCAACTCTCATCGGGC (974991) (Tomaso et al., 2005)
-
Real-time-probe:
Burk FL: CCAGTAATTCCGATTAACGCTCGC X (513536); Burk LC: LC-Red640-CCCTACGTATTACCGCGGCTGCT p (489511) (Tomaso et al., 2005)
-
Product
-
Name: 16S ribosomal RNA gene
-
Size: 1488 bp
-
Product GenBank Accession Number:
AY305818
-
Target: Flagellin C (fliC)
-
Forward:
fliC S: AAGGGCGGCTTCACGTTCA (13831401) (Tomaso et al., 2005)
-
Reverse:
fliC A: GTGCTGATGTCGAGGTTCGAGA (16061627) (Tomaso et al., 2005)
-
Real-time-probe:
Burk fliC FL:CAGCGCGCTGTCCGCGACG X (15261543): Burk fliC LC: LC-Red640-CCAGGCGAACGCCACGGCGA p (15471566) (Tomaso et al., 2005)
-
Product
-
Name: Flagellin (fliC) gene
-
Product GenBank Accession Number:
AF084813
-
Target: Ribosomal protein subunit S21 (rpsU)
-
Forward:
UF2: GAGCTTCTTCGGCAGCA (1127) (Tomaso et al., 2005)
-
Reverse:
UR2: ATCAAGCAAATTAGGAACGACAT (216238) (Tomaso et al., 2005)
-
Real-time-probe:
P1: CGGCGGTCGGCTTCTC X (88103); P2: LC-Red640-ATGCCTGGCGCTCGCG p (106121) (Tomaso et al., 2005)
-
Product
-
Name: Ribosomal protein S21 gene
-
Product GenBank Accession Number:
U73848
-
Nested PCR assay:
-
Description:
This report describes an optimised protocol for fast and reliable DNA preparation for use in two different polymerase chain reaction (PCR) assays, namely: (1) a seminested PCR assay targeting a genus specific sequence of the ribosomal protein subunit 21 (rpsU) gene and (2) a nested PCR assay targeting the gene encoding the filament forming flagellin (fliC). Various strains of Burkholderia spp, strains of closely related genera, and spleen tissue samples of experimentally infected mice were investigated. The combination of PCR and sequencing of the amplicons resulted in high sensitivity and specificity. These procedures may allow rapid, sensitive, and reliable detection of B pseudomallei DNA in routinely formalin fixed and paraffin wax embedded samples, thus providing a safe diagnostic tool and avoiding the cultivation of a risk group 3 agent. In addition, this method could be useful for retrospective histopathological investigations (Hagen et al., 2002).
The rpsU PCR using the fup-1/fup-2 primers was performed under the following conditions: an initial denaturation step of 10 minutes at 94C was followed by 35 cycles of denaturation for 60 seconds at 94C, annealing for 60 seconds at 59C, and elongation at 72C for 60 seconds. An additional elongation step was performed for 10 minutes at 72C. Further amplification of 0.5 l aliquots was performed by seminested PCR using the rpsU-L2/fup-2 primers and applying the same conditions as the initial amplification except that annealing was carried out at 53C. An already developed B mallei/B pseudomallei/B thailandensis specific filament forming flagellin (fliC) PCR assay based on primers fliC-1/fliC-29 was connected with a nested (inner) PCR assay using primers fliC-3/fliC-4 (Hagen et al., 2002).
-
Primers:
-
Target: Ribosomal protein subunit 21 (rpsU) gene
-
Target: Ribosomal protein subunit 21 (rpsU) gene
-
Target: Filament forming flagellin (fliC)
-
Target: filament forming flagellin (fliC)
-
Multiplex PCR for typing B. pseudomallei:
-
Description:
The technique of multiplex PCR has proved to be a rapid and simple method for typing B. pseudomallei. The type patterns correlated with the ability of the organism to assimilate Image-arabinose and two types (M4, M15) were associated with the most serious clinical profile of melioidosis found in patients in the northeastern part of Thailand. This method is not only useful in clinical analysis but will also be of great use in the future study of B. pseudomallei epidemiology (Wongratanacheewin et al., 2000).
-
Primers:
-
Other Types of Diagnostic Tests:
-
Biochemical Identification:
-
Ontology:
UMLS:xxx, GO:xxx, SNOMED:xxx, otherStd:xxx
-
Description:
To distinguish B. pseudomallei from B. cepacia, the determination of arginine dihydrolase (ADH), lysine decarboxylase (LDC), ortho-nitrophenyl-gamma-d-galactopyranosidase (ONPG) and the reduction from nitrate to nitrite (NIT) can be used. B. pseudomallei is ADH- and NIT-positive and LDC- and ONPG-negative, whereas B. cepacia is ADH- and NIT-negative but LDC- and ONPG-positive. B. thailandensis strains assimilate l-arabinose whereas B. pseudomallei is not able to assimilate arabinose (Sprague and Neubauer, 2004).
-
API 20NE, 20E and Vitek systems identification of Burkholderia pseudomallei:
-
Ontology:
UMLS:C0201145
-
Description:
This study compares the manual API 20NE and 20E identification systems with the automated Vitek 1 and 2 systems. A total of 103 B. pseudomallei isolates were tested and correctly identified in 98%, 99%, 99%, and 19% of cases, respectively. The failure of the Vitek 2 to correctly identify B. pseudomallei was largely due to differences in the biochemical reactions achieved compared to expected values in the database. It is suggested that this deficiency in the Vitek 2 may be due to the large number of uncertain results reported for these isolates. These results reduce the discriminating ability of the instrument to distinguish between uncommonly encountered isolates such as those of B. pseudomallei (Lowe et al., 2002).
V. References
A. Journal References:
Anuntagool et al., 2000:
Anuntagool N,
Naigowit P,
Petkanchanapong V, Aramsri P, Panichakul T, Sirisinha S. Monoclonal antibody-based rapid identification of Burkholderia pseudomallei in blood culture fluid from patients with community-acquired septicaemia.
Journal of Medical Microbiology.
2000;
49(12):
1075 -
1078.
[PubMed:
11129718].
Ashdown, 1979:
Ashdown LR. An improved screening technique for isolation of Pseudomonas pseudomallei from clinical specimens.
Pathology.
1979;
11(2):
293 -
297.
[PubMed:
460953].
Bossi et al., 2004:
Bossi P,
Tegnell A,
Baka A, van Loock F, Hendriks J, Werner A, Maidhof H, Gouvras G. Bichat guidelines for the clinical management of glanders and melioidosis and bioterrorism-related glanders and melioidosis.
Euro surveillance : European communicable disease bulletin.
2004;
9(12):
1 -
6.
[PubMed:
15677841].
CDC Report, 2004:
CDC Report Laboratory exposure to Burkholderia pseudomallei--Los Angeles, California, 2003.
MMWR. Morbidity and Mortality Weekly Report.
2004;
53(42):
988 -
990.
[PubMed:
15514581].
Choy et al., 2000:
Choy JL,
Mayo M M,
Janmaat A, Currie BJ. Animal melioidosis in Australia.
Acta Tropica.
2000;
74(2-3):
153 -
158.
[PubMed:
10674644].
Currie, 2003:
Currie BJ. Melioidosis: an important cause of pneumonia in residents of and travellers returned from endemic regions.
The European Respiratory Journal.
2003;
22(3):
542 -
550.
[PubMed:
14516149].
Currie et al., 2000 (a):
Currie BJ,
Fisher DA,
Howard DM, Burrow JN, Selvanayagam S, Snelling PL, Anstey NM, Mayo MJ. The epidemiology of melioidosis in Australia and Papua New Guinea.
Acta Tropica.
2000;
74(2-3):
121 -
127.
[PubMed:
10674639].
Currie et al., 2000 (b):
Currie BJ,
Fisher DA,
Anstey NM, Jacups SP. Melioidosis: acute and chronic disease, relapse and re-activation.
Transactions of the Royal Society of Tropical Medicine and Hygiene.
2000;
94(3):
301 -
304.
[PubMed:
10975006].
Currie et al., 2000 (c):
Currie BJ,
Fisher DA,
Howard DM, Burrow JN. Neurological melioidosis.
Acta Tropica.
2000;
74(2-3):
145 -
151.
[PubMed:
10674643].
Dance, 2000 (a):
Dance DA Ecology of Burkholderia pseudomallei and the interactions between environmental Burkholderia spp. and human-animal hosts.
Acta Tropica.
2000;
74(2-3):
159 -
168.
[PubMed:
10674645].
Dance, 2000 (b):
Dance DA Melioidosis as an emerging global problem.
Acta Tropica.
2000;
74(2-3):
115 -
119.
[PubMed:
10674638].
Dance, 2002:
Dance DA. Melioidosis.
Current Opinion in Infectious Diseases.
2002;
15(2):
127 -
132.
[PubMed:
11964912].
Dharakul et al., 1999:
Dharakul T,
Songsivilai S,
Smithikarn S, Thepthai C, Leelaporn A. Rapid identification of Burkholderia pseudomallei in blood cultures by latex agglutination using lipopolysaccharide-specific monoclonal antibody.
The American Journal of Tropical Medicine and Hygiene.
1999;
61(4):
658 -
662.
[PubMed:
10548306].
Essex-Lopresti et al., 2005:
Essex-Lopresti AE,
Boddey JA,
Thomas R, Smith MP, Hartley MG, Atkins T, Brown NF, Tsang CH, Peak IR, Hill J, Beacham IR, Titball RW. A type IV pilin, PilA, Contributes To Adherence of Burkholderia pseudomallei and virulence in vivo.
Infection and Immunity.
2005;
73(2):
1260 -
1264.
[PubMed:
15664977].
Hagen et al., 2002:
Hagen RM,
Gauthier YP,
Sprague LD, Vidal DR, Zysk G, Finke EJ, Neubauer H. Strategies for PCR based detection of Burkholderia pseudomallei DNA in paraffin wax embedded tissues.
Molecular Pathology.
2002;
55(6):
398 -
400.
[PubMed:
12456780].
Hicks et al., 2000:
Hicks CL,
Kinoshita R,
Ladds PW. Pathology of melioidosis in captive marine mammals.
Australian Veterinary Journal.
2000;
78(3):
193 -
195.
[PubMed:
10860161].
Holden et al., 2004:
Holden MT,
Titball RW,
Peacock SJ, Cerdeno-Tarraga AM, Atkins T, Crossman LC, Pitt T, Churcher C, Mungall K, Bentley SD, Sebaihia M, Thomson NR, Bason N, Beacham IR, Brooks K, Brown KA, Brown NF, Challis GL, Cherevach I, Chillingworth T, Cronin A, Crossett B, Davis P, DeShazer D, Feltwell T, Fraser A, Hance Z, Hauser H, Holroyd S, Jagels K, Keith KE, Maddison M, Moule S, Price C, Quail MA, Rabbinowitsch E, Rutherford K, Sanders M, Simmonds M, Songsivilai S, Stevens K, Tumapa S, Vesaratchavest M, Whitehead S, Yeats C, Barrell BG, Oyston PC, Parkhill J. Genomic plasticity of the causative agent of melioidosis, Burkholderia pseudomallei.
Proceedings of the National Academy of Sciences of the United States of America.
2004;
101(39):
14240 -
14245.
[PubMed:
15377794].
Hoppe et al., 1999:
Hoppe I,
Brenneke B,
Rohde M, Kreft A, Haussler S, Reganzerowski A, Steinmetz I. Characterization of a murine model of melioidosis: comparison of different strains of mice.
Infection and Immunity.
1999;
67(6):
2891 -
2900.
[PubMed:
10338496].
Howard and Inglis, 2003:
Howard K,
Inglis TJ. Novel selective medium for isolation of Burkholderia pseudomallei.
Journal of Clinical Microbiology.
2003;
41(7):
3312 -
3316.
[PubMed:
12843080].
Jeddeloh et al., 2003:
Jeddeloh JA,
Fritz DL,
Waag DM, Hartings JM, Andrews GP. Biodefense-driven murine model of pneumonic melioidosis.
Infection and Immunity.
2003;
71(1):
584 -
587.
[PubMed:
12496217].
Jenney et al., 2001:
Jenney AW,
Lum G,
Fisher DA, Currie BJ. Antibiotic susceptibility of Burkholderia pseudomallei from tropical northern Australia and implications for therapy of melioidosis.
International Journal of Antimicrobial Agents.
2001;
17(2):
109 -
113.
[PubMed:
11165114].
Kespichayawattana et al., 2004:
Kespichayawattana W,
Intachote P,
Utaisincharoen P, Sirisinha S. Virulent Burkholderia pseudomallei is more efficient than avirulent Burkholderia thailandensis in invasion of and adherence to cultured human epithelial cells.
Microbial Pathogenesis.
2004;
36(5):
287 -
292.
[PubMed:
15043863].
Lee et al., 2005:
Lee MA,
Wang D,
Yap EH. Detection and differentiation of Burkholderia pseudomallei, Burkholderia mallei and Burkholderia thailandensis by multiplex PCR.
FEMS Immunology and Medical Microbiology.
2005;
43(3):
413 -
417.
[PubMed:
15708316].
Leelarasamee, 1998:
Leelarasamee A. Burkholderia pseudomallei: the unbeatable foe?.
Southeast Asian Journal of Tropical Medicine and Public Health.
1998;
29(2):
410 -
415.
[PubMed:
9886137].
Leelarasamee, 2000:
Leelarasamee A. Melioidosis in Southeast Asia.
Acta Tropica.
2000;
74(2-3):
129 -
132.
[PubMed:
10674640].
Leelarasamee, 2004:
Leelarasamee A. Recent development in melioidosis.
Current Opinion in Infectious Diseases.
2004;
17(2):
131 -
136.
[PubMed:
15021053].
Lowe et al., 2002:
Lowe P,
Engler C,
Norton R. Comparison of automated and nonautomated systems for identification of Burkholderia pseudomallei.
Journal of Clinical Microbiology.
2002;
40(12):
4625 -
4627.
[PubMed:
12454163].
Luo et al., 2003:
Luo CY,
Ko WC,
Lee HC, Yang YJ. Relapsing melioidosis as cause of iliac mycotic aneurysm: an indigenous case in Taiwan.
Journal of Vascular Surgery.
2003;
37(4):
882 -
885.
[PubMed:
12663992].
McCormick et al., 1975:
McCormick JB,
Sexton DJ,
McMurray JG, Carey E, Hayes P, Feldman RA. Human-to-human transmission of Pseudomonas pseudomallei.
Annals of Internal Medicine.
1975;
83(4):
512 -
513.
[PubMed:
1174405].
Moore et al., 2004:
Moore RA,
Reckseidler-Zenteno S,
Kim H, Nierman W, Yu Y, Tuanyok A, Warawa J, DeShazer D, Woods DE. Contribution of gene loss to the pathogenic evolution of Burkholderia pseudomallei and Burkholderia mallei.
Infection and Immunity.
2004;
72(7):
4172 -
4187.
[PubMed:
15213162].
Na-ngam et al., 2004:
Na-ngam N,
Angkititakul S,
Noimay P, Thamlikitkul V. The effect of quicklime (calcium oxide) as an inhibitor of Burkholderia pseudomallei.
Transactions of the Royal Society of Tropical Medicine and Hygiene.
2004;
98(6):
337 -
341.
[PubMed:
15099988].
Pongsunk et al., 1999:
Pongsunk S,
Thirawattanasuk N,
Piyasangthong N, Ekpo P. Rapid identification of Burkholderia pseudomallei in blood cultures by a monoclonal antibody assay.
Journal of Clinical Microbiology.
1999;
37(11):
3662 -
3667.
[PubMed:
10523570].
Powell et al., 2003:
Powell K,
Ulett G,
Hirst R, Norton R. G-CSF immunotherapy for treatment of acute disseminated murine melioidosis.
FEMS Microbiology Letters.
2003;
224(2):
315 -
318.
[PubMed:
12892898].
Ralph et al., 2004:
Ralph A,
McBride J,
Currie BJ. Transmission of Burkholderia pseudomallei via breast milk in northern Australia.
The Pediatric Infectious Disease Journal.
2004;
23(12):
1169 -
1171.
[PubMed:
15626961].
Sirisinha et al., 1998:
Sirisinha S,
Anuntagool N,
Intachote P, Wuthiekanun V, Puthucheary SD, Vadivelu J, White NJ. Antigenic differences between clinical and environmental isolates of Burkholderia pseudomallei.
Microbiology and immunology.
1998;
42(11):
731 -
737.
[PubMed:
9886145].
Siritapetawee et al., 2004:
Siritapetawee J,
Prinz H,
Krittanai C, Suginta W. Expression and refolding of Omp38 from Burkholderia pseudomallei and Burkholderia thailandensis, and its function as a diffusion porin.
The Biochemical Journal.
2004;
384(Pt3):
609 -
617.
[PubMed:
15329048].
Smith et al., 1997:
Smith MD,
Angus BJ,
Wuthiekanun V, White NJ. Arabinose assimilation defines a nonvirulent biotype of Burkholderia pseudomallei.
Infection and Immunity.
1997;
65(10):
4319 -
4321.
[PubMed:
9317042].
Songsivilai and Dharakul, 2000:
Songsivilai S,
Dharakul T Multiple replicons constitute the 6.5-megabase genome of Burkholderia pseudomallei.
Acta Tropica.
2000;
74(2-3):
169 -
179.
[PubMed:
10674646].
Sonthayanon et al., 2002:
Sonthayanon P,
Krasao P,
Wuthiekanun V, Panyim S, Tungpradabkul S. A simple method to detect and differentiate Burkholderia pseudomallei and Burkholderia thailandensis using specific flagellin gene primers.
Molecular and Cellular Probes.
2002;
16(3):
217 -
222.
[PubMed:
12144773].
Sprague and Neubauer, 2004:
Sprague LD,
Neubauer H. Melioidosis in animals: a review on epizootiology, diagnosis and clinical presentation.
Journal of Veterinary Medicine. B, Infectious Diseases and Veterinary Public Health.
2004;
51(7):
305 -
320.
[PubMed:
15525357].
Steinmetz et al., 1999:
Steinmetz I,
Reganzerowski A,
Brenneke B, Haussler S, Simpson A, White NJ. Rapid identification of Burkholderia pseudomallei by latex agglutination based on an exopolysaccharide-specific monoclonal antibody.
Journal of Clinical Microbiology.
1999;
37(1):
225 -
228.
[PubMed:
9854098].
Stevens et al., 2004:
Stevens MP,
Haque A,
Atkins T, Hill J, Wood MW, Easton A, Nelson M, Underwood-Fowler C, Titball RW, Bancroft GJ, Galyov EE. Attenuated virulence and protective efficacy of a Burkholderia pseudomallei bsa type III secretion mutant in murine models of melioidosis.
Microbiology.
2004;
150(Pt 8):
2669 -
2676.
[PubMed:
15289563].
Thepthai et al., 2001:
Thepthai C,
Dharakul T,
Smithikarn S, Trakulsomboon S, Songsivilai S. Differentiation between non-virulent and virulent Burkholderia pseudomallei with monoclonal antibodies to the Ara+ or Ara- biotypes.
The American Journal of Tropical Medicine and Hygiene.
2001;
65(1):
10 -
12.
[PubMed:
11504398].
Thibault et al., 2004:
Thibault FM,
Hernandez E,
Vidal DR, Girardet M, Cavallo JD. Antibiotic susceptibility of 65 isolates of Burkholderia pseudomallei and Burkholderia mallei to 35 antimicrobial agents.
The Journal of Antimicrobial Chemotherapy.
2004;
54(6):
1134 -
1138.
[PubMed:
15509614].
Tomaso et al., 2005:
Tomaso H,
Pitt TL,
Landt O, Al Dahouk S, Scholz HC, Reisinger EC, Sprague LD, Rathmann I, Neubauer H. Rapid presumptive identification of Burkholderia pseudomallei with real-time PCR assays using fluorescent hybridization probes.
Molecular and Cellular Probes.
2005;
19(1):
9 -
20.
[PubMed:
15652215].
Valade et al., 2004:
Valade E,
Thibault FM,
Gauthier YP, Palencia M, Popoff MY, Vidal DR. The PmlI-PmlR quorum-sensing system in Burkholderia pseudomallei plays a key role in virulence and modulates production of the MprA protease.
Journal of Bacteriology.
2004;
186(8):
2288 -
2294.
[PubMed:
15060030].
White et al., 2003:
White NJ. Melioidosis.
Lancet.
2003;
361(9370):
1715 -
1722.
[PubMed:
12767750].
Wongratanacheewin et al., 2000:
Wongratanacheewin S,
Komutrin K,
Sermswan RW. Use of multiplex PCR patterns as genetic markers for Burkholderia pseudomallei.
Acta Tropica.
2000;
74(2-3):
193 -
198.
[PubMed:
10674649].
Wongratanacheewin et al., 2004:
Wongratanacheewin S,
Kespichayawattana W,
Intachote P, Pichyangkul S, Sermswan RW, Krieg AM, Sirisinha S. Immunostimulatory CpG oligodeoxynucleotide confers protection in a murine model of infection with Burkholderia pseudomallei.
Infection and Immunity.
2004;
72(8):
4494 -
4502.
[PubMed:
15271908].
Woods et al., 1999:
Woods DE,
DeShazer D,
Moore RA, Brett PJ, Burtnick MN, Reckseidler SL, Senkiw MD. Current studies on the pathogenesis of melioidosis.
Microbes and Infection.
1999;
1(2):
157 -
162.
[PubMed:
10594980].
Wuthiekanun et al., 2005:
Wuthiekanun V,
Desakorn V,
Wongsuvan G, Amornchai P, Cheng AC, Maharjan B, Limmathurotsakul D, Chierakul W, White NJ, Day NP, Peacock SJ. Rapid immunofluorescence microscopy for diagnosis of melioidosis.
Clinical and Diagnostic Laboratory Immunology.
2005;
12(4):
555 -
556.
[PubMed:
15817767].
B. Book References:
No book references used.
C. Website References:
Website 1:
NCBI. [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=28450&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 2:
NCBI. [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=95163&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 3:
NCBI. [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=272560&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 4:
NCBI. Homo Sapiens [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9606
].
Website 5:
NCBI. Sheep [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9938&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 6:
NCBI. Goats [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9925
].
Website 7:
NCBI. Bovine [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9913
].
Website 8:
NCBI. Pigs [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9823&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 9:
NCBI. Horses [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9788&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 10:
NCBI. Dogs [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9615&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 11:
NCBI. Cats [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9685
].
Website 12:
NCBI. Camels [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9838
].
Website 14:
NCBI. Fallow deer [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=30532
].
Website 15:
NCBI. Kangaroo [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9322
].
Website 16:
NCBI. Koala [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=38626&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 17:
NCBI. Grey parrot [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=57247
].
Website 18:
NCBI. Cockatoo [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=141274&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 19:
NCBI. Whales [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=82174
].
Website 20:
NCBI. Killer whale [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9733
].
Website 21:
NCBI. Dolphin [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9739
].
Website 22:
NCBI. Pacific white-sided dolphin [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=90247
].
Website 23:
NCBI. Sea lion [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9704
].
Website 24:
NCBI. Grey seal [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9711
].
Website 25:
NCBI. Primates [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9443
].
Website 26:
NCBI. Rodents [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9989
].
Website 27:
NCBI. Animals [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=33208&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 28:
Pic [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=320371&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 29:
Pic [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=320372&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 30:
Pic [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=320373&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 31:
Pic [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=320374&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 32:
Pic [
TEXT
].
D. Thesis References:
No thesis or dissertation references used.
VI. Curation Information
-
Curators:
George Abramochkin
-
Date: 04.06.05
-
Version: 1.0
-
Note: This is the first complete version of the Burkholderia pseudomallei information
-
Contact information:
- Email: georg@vbi.vt.edu or pathinfo@vbi.vt.edu